"CACGGAGTTTATTTTAACATATTGGTATAATTGTCGTCTTGAGCGGTGTTTAACATGTTGCAGTCTTCGTTGGCCGGAGGATACTTGTCTTGGTAGTTGTTAGGAGCATCCTCGTTGTACTAGTGGTTTAACATGTTGCTCGGTGTATCGTTGTATGTTGCATACGGATCTTTGGTATCGTTGTCGTCTTCCGCATACGGGGGATTTAACATGTTGGTATAATTGGCCTGAGTAGTTGCTGTATACGGGTTGGCATTGTCGGGTGTATATTTGTACTAGTGGTTTAACATGTTGGTATCTTCGTTGGCCGGAGGATACTTGTCTGGTTCCGGAGGATTGTTAGGAGCATCCTCGTTTAACATGTTGGTATTGTACGGATGCGGATCCTTGGTGTACGGATGGTTGGGTTAGTGGTTGTAAGCATACTTATTGTATGTTGCATACGGATCTTCGTTGTCTGGTGGATCCGGATTGTGGGGATCCGGATTGGTATACTTGTCTGGTGGATTGTCGGTGTTATTTAACATGTTGGTATCTTCGTTGGCCGGAGGATACTTGGGCTAGTGATCCTTGTTAGGAGCATCCTCGTTGTACTAGTGGTTTAACATGTTGTCTGGTGGATCCGGATTGGCATCCGGATTGTCTGGTGTATACGGGTCGTTGGCATCTTCTGCAGCGGTGGTATACGGGTTGTAAGGATTTAACATGTTGGGCGTATGCGGATTTAACATGTTGGTATAATTGTCGTCTTGAGCGGTGTTTAACATGTTGTCGGTATGTTTTAACATGTTGGGTGGAGTTTATTTTAACATGTTTAGCAGGGCGTAGTAGTCCGCTGTATACGCATCTGGATCGTTGGCATCCGGATTGGACTTTAAGAGGTTGTTTAACATCAACACCAGCACGAACAAAAATAATTTGGAGTTTAAGAGGTTGTTTAACATCAATAAGAATACAAATACGACAACT" - The message ends.
I threw this into a translator. "HGVYFNILV.LSS.AVFNMLQSSLAGGYLSW.LLGASSLY.WFNMLLGVSLYVAYGSLVSLSSSAYGGFNMLV.LA.VVAVYGLALSGVYLY.WFNMLVSSLAGGYLSGSGGLLGASSFNMLVLYGCGSLVYGWLG.WL.AYLLYVAYGSSLSGGSGLWGSGLVYLSGGLSVLFNMLVSSLAGGYLG..SLLGASSLY.WFNMLSGGSGLASGLSGVYGSLASSAAVVYGL.GFNMLGVCGFNMLV.LSS.AVFNMLSVCFNMLGGVYFNMFSRA..SAVYASGSLASGLDFKRLFNINTSTNKNNLEFKRLFNINKNTNTTT" Looks like it's mostly nonsense. Damn. -Corvus
Yep. I tried turning it into an Amino Acid sequence with a translator, but obviously I just got gobbly-guk.
The message plays again, but it sounds somewhat different. "Svok, R'n hgfxp. Rg'h yvvm gdl bvzih mld. Gsrh kozmvg rh hgizmtv. R'n yfrowrmt z hsrk, xzoormt rg gsv nllm. Rg'h yvvm gsivv bvzih. R mvevi pmvd sld nzmb kozmvgh gsviv dviv rm gsv hpb. Ulfi bvzih mld. Gsviv ziv gsrmth zggzxprmt nv, yrt... zmw hxzib gsrmth. Orpv nlmhgvih fmwvi blfi yvw. Urev. R'n wlmv drgs gsv hsrk, ovzermt mld. Hrc, xizhs ozmwvw lm z kozmvg drgs sfnzmh, nb kvlkov ziv sviv, yfg gsvb zivm'g mrxv. Wl gsvb szgv nv? Hvevm. Gsv sfnzm nrorgzib girvw gl proo nv, rh gsrh dszg lgsvi kvlkov wl mlinzoob? rg'h yvvm hl olmt, R'ev yvvm lm gsv ifm uli szou z bvzi mld, rm gsrh kozmvgh grnv zg ovzhg. R'ev yvvm xzkgfivw. Gsvb wlm'g hvv nb qlfimzo. Hvmw uli svok; R nrtsg kozb gsrh nvhhztv lfg gl dslvevi xzm svzi gsrh. Gsvb nzwv nv rmgl z nlmhgvi, R szev hl orggov uovhs mld. Svok. R vhxzkvw, drgs nb "mvd ylwb". Hglov z hsrk. Rg'h xzoovw gsv nzillm. Vrtsg bvzih mld. R xizhsvw gsv nzillm... R'n mlg gsv yvhg krolg mld. Hlnv nlmpvb "gsrmth" ziv svokrmt nv. Gsvb hzb rg'oo zoo yv levi hllm, rm hxzivw.. Mrmv. Gsvb ziv zoo wvzw. Hlnv hlig lu "kzmwvnrx". Lmv dzh nb uirvmw. Ivhg rm kvzxv. Gvm. R'n hgroo dzrgrmt uli svok... hxzivw gl trev lfg mfnyvih uli z olxzgrlm... R mvvw z ivkob. R mvvw hlnvlmv gl xlnv svok. Gsrh xzm'g yv gsv vmw. Kovzhv wvxlwv gsrh hvxivg xrksvi. rgh gsv lmob dzb blf xzm svzi gsrh yvuliv gsv nrorgzib. Kovzhv. Svok." The message ends.
-Anastazy- Tried to brute-force a Caesar decryption, didn't work. In case anybody wants to try a frequency analysis, here's a partial list of the number of letters in the message. http://i.gyazo.com/6afc82f227cfddfec41a9c4f5e99f6ff.png EDIT: Not a ROT5, it could be a Running Key cipher. In that case, the odds of decryption are close to none. If it's a Keyword cipher, then we have about the same chance of decrypting it as a Running Key. Assuming it's code and not random gibberish, of course. ((Pretend it's a spacelink or whatever, I'm unfamiliar with this forum formatting software, and couldn't figure out how to make it look fancy and RP-ish)) ((OOC edit: I assumed it was text as it was labeled 'message' instead of 'transmission'. Woops?))
"How... the heck does ANYONE know what to translate with this? It's a radio message that just sounds like gibberish. Not even a speech-to-text system would be able to pick everything up." -Radio Message ((Aedan)) ((Also, yes, it is audio. Please don't metagame it as being text. it would literally sound like gibberish coming in as a message.))
(( Oh, yeah, you're right. I'm honestly stumped on what to do now, as there are a lot of dependencies. Eck. ))
The sound 'SSVAHK' seems to be prominent, as it opens and closes the message. Other than that it sounds like stellar interference static to me...
THIS CHAT BELOW IS ALL OOC!!! would you guys like hints?! and yes, im also new to the forums and formatting, so please tell me if i make any mistakes. ... also, yes. "message" means "transmission" (or "interstellar-broadcast") EDIT: Just as the first post, words are said letter to letter, not all in one. (for both transmissions) so you would hear "S-v-o-k-(silence)-(next letter)-" and so on... like morose code sounding, sorta. If im doing any of this wrong... (META or whatelse...) please tell me Thanks! ~Willow
((transmitted as audio, but you hear every single letter individually, with pauses in between words.)) ((periods, question marks, commas, and any other thing like these, are said as they are. "comma" "period". so you may hear them as something else (ICly), but they are said as that.))
(( Oh, good. Cause, like Aedan pointed out, I realized that, as a normal audio message, it would be really had to tell. ))
((well now that you know, is there anything else? hints? a little shove in the right direction? or anything else you need, feel free to ask!))
((cracked your code, that was super fun ICly my character is beginning to get through)) After some analysis, I have deciphered bits and pieces of the message. It seems to be a distress call of some sort at first, however it is clearly a message broadcast over a long period of time, starting out with a time stamp of two years, reaching five years a few messages later, etc... Kind of like a journal. It seems like he builds a ship, but he might also have built... a moon? Later on it seems he has landed on some planet with other humans, suggesting he is a human. 'Not nice' is mentioned in conjunction with 'humans' so he may have found some bandits or a hostile USCM base. The military seems to attempt to kill him at year seven. From what I can tell he's been captured. If i translate one part correctly, it reads '...me into a monster.I have so little flesh now. Help.' Afterward he 'escapes with his "new body"'. He mentions stealing a marooned ship... or something like that. He crashes his ship again it seems. He says something about 'monkey things' helping him out, suggesting an encounter with Apex. The next year all the Apex die in a pandemic, one of them his friend. Year ten, hes still looking for help but hesitant to disclose a location. He hopes we can decipher it before the military. Some little bits are missing but that's the gist of it. Dont know if there's much I can do now, but I'll try tracing the origin of the signal. *attempts to find origin of the signal by triangulation*
